1. Search Result
Search Result
Results for "

murine

" in MedChemExpress (MCE) Product Catalog:

264

Inhibitors & Agonists

4

Biochemical Assay Reagents

32

Peptides

25

Inhibitory Antibodies

37

Natural
Products

9

Recombinant Proteins

11

Isotope-Labeled Compounds

5

Antibodies

1

Click Chemistry

Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-132582A

    Tau Protein Cancer
    Tau ASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (Tau ASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )
    Tau ASO-12 (<em>murine</em>) (sodium)
  • HY-N1713

    Others Neurological Disease
    29-Nor-20-oxolupeol, extracted from Impatiens basamina, reduces NO levels in LPS-activated murine microglial cells with an IC50 of 44.21 µM .
    29-Nor-20-oxolupeol
  • HY-E70085

    DNA/RNA Synthesis Infection
    Moloney murine leukemia virus RT is a monomeric reverse transcriptase from Moloney murine leukemia virus (MMLV). Moloney murine leukemia virus RT is a replicative polymerase that play an essential role in the life cycle of the retrovirus .
    Moloney <em>murine</em> leukemia virus RT
  • HY-155288

    Others Cancer
    DosatiLink-1 is an Abelson murine leukemia (ABL) enzyme inhibitor .
    DosatiLink-1
  • HY-N10445

    CD28 CD3 Inflammation/Immunology
    Maydispenoid A is a potent immunosuppressor. Maydispenoid A can inhibit anti-CD3/anti-CD28 mAbs activated and lipopolysaccharide activated murine splenocyte proliferation .
    Maydispenoid A
  • HY-N10446

    CD28 CD3 Inflammation/Immunology
    Maydispenoid B is a potent immunosuppressor. Maydispenoid B can inhibit anti-CD3/anti-CD28 mAbs activated and lipopolysaccharide activated murine splenocyte proliferation .
    Maydispenoid B
  • HY-146345

    Antibiotic Infection
    Antiviral agent 18 (Compound 5) is an anti-infection agent. Antiviral agent 18 results in good antiviral activity against murine norovirus. Antiviral agent 18 has the potential for the research of infectious and malignant diseases .
    Antiviral agent 18
  • HY-P1293

    iGluR Neurological Disease
    Conantokin G, a 17-amino-acid peptide, is a potent, selective and competitive antagonist of N-methyl-D-aspartate (NMDA) receptors. Conantokin G inhibits NMDA-evoked currents in murine cortical neurons with an IC50 of 480 nM. Conantokin G has neuroprotective properties .
    Conantokin G
  • HY-117365

    Others Cancer
    MI-1481 is a highly potent inhibitor of the Menin-MLL1 interaction with IC50 of 3.6 nM. MI-1481 markedly reduces cell growth of murine bone marrow cells transformed and inhibits leukemia progression .
    MI-1481
  • HY-P1293A

    iGluR Neurological Disease
    Conantokin G TFA, a 17-amino-acid peptide, is a potent, selective and competitive antagonist of N-methyl-D-aspartate (NMDA) receptors. Conantokin G TFA inhibits NMDA-evoked currents in murine cortical neurons with an IC50 of 480 nM. Conantokin G TFA has neuroprotective properties .
    Conantokin G TFA
  • HY-163327

    Others Neurological Disease
    pFBC ([ 18F]pEBC) is a covalent CLIP-tag radiotracer for detection of viral reporter gene transfer in the murine brain. pFBC can be used in neurobiological research .
    pFBC
  • HY-146344

    Antibiotic Infection
    Antiviral agent 17 (Compound 4) is an anti-infection agent. Antiviral agent 17 retains its antiviral effect in a human replicon assay (EC50 = 0.015 μM). Antiviral agent 17 results in good antiviral activity against murine norovirus. Antiviral agent 17 has the potential for the research of infectious and malignant diseases .
    Antiviral agent 17
  • HY-P99177

    SARS-CoV Infection Cardiovascular Disease
    Enibarcimab is a humanised murine monoclonal immunoglobulin G1 (IgG1) antibody, could be used for acute heart failure, COVID-19 infections and septic shock research .
    Enibarcimab
  • HY-P99336

    BI-RR 0001; Anti-Human IL6 Recombinant Antibody

    Integrin Neurological Disease Inflammation/Immunology
    Enlimomab (BI-RR 0001), a murine IgG2a monoclonal antibody to the human ICAM-1, inhibits leukocyte adhesion to the vascular endothelium, thereby decreasing leukocyte extravasation and inflammatory tissue injury. Enlimomab has anti-inflammatory effects, and can be used for stroke research .
    Enlimomab
  • HY-121726

    mTOR Autophagy Cardiovascular Disease
    3HOI-BA-01 is amTORinhibitor.3HOI-BA-01reduces infarct size and inducedautophagyin a murine myocardial ischemia/reperfusion injury model .
    3HOI-BA-01
  • HY-145441

    Others Cancer
    GEM–IB is the conjugate of gemcitabine (GEM)-5'-phosphate with ibandronate (IB). GEM–IB as a single agent or in combination with Docetaxel (DTX) demonstrates reduced tumor burden, preservation of the bone architecture, and improved the survival in a murine model of osteosarcoma (OS) .
    GEM–IB
  • HY-12836A

    IFNAR Inflammation/Immunology
    IFN alpha-IFNAR-IN-1 hydrochloride is a nonpeptidic, low-molecular-weight inhibitor of the interaction between IFN-α and IFNAR. IFN alpha-IFNAR-IN-1 hydrochloride inhibits modified Vaccinia virus ankara (MVA)-induced IFN-α responses in murine bone-marrow-derived, Flt3- L-differentiated pDC cultures (BM-pDCs) (IC50=2-8 μM) .
    IFN alpha-IFNAR-IN-1 hydrochloride
  • HY-151808

    Btk Cancer
    JS25 is a selective and covalent inhibitor of BTK that inactivates BTK with an IC50 value of 5.8 nM by chelating Tyr551. JS25 inhibits cancer cells proliferation, pronounces cell death, and promotes murine xenograft model of Burkitt’s lymphoma. JS25 effectively crosses the blood-brain barrier .
    JS25
  • HY-N1388
    Tussilagone
    1 Publications Verification

    Others Inflammation/Immunology
    Tussilagone, a major active component in Tussilago farfara, has anti-inflammatory effect. Tussilagone ameliorates inflammatory responses in dextran sulphate sodium-induced murine colitis. Tussilagone inhibits the inflammatory response and improves survival in cecal ligation and puncture (CLP)-induced septic mice .
    Tussilagone
  • HY-N1649

    Others Cancer
    2,3,2'',3''-Tetrahydroochnaflavone is a biflavonoid, which can be isolated from the leaves of Quintinia acutifolia. 2,3,2'',3''-Tetrahydroochnaflavone shows some cytotoxicity against P388 murine lymphocytic leukemia cells, with an IC50 of 8.2 µg/mL .
    2,3,2'',3''-Tetrahydroochnaflavone
  • HY-W272217

    n-Octacosane; NSC 5549

    Endogenous Metabolite Bacterial Inflammation/Immunology Cancer
    Octacosane is an endogenous metabolite with antibacterial activity. Octacosane shows high cytotoxicity against murine melanoma B16F10-Nex2 cells besides inducing protection against a grafted subcutaneous melanoma. Octacosane has the larvicidal activity against mosquito Culex quinquefasciatus with the LC50 concentration of 7.2 mg/l .
    Octacosane
  • HY-160142

    Btk Cancer
    UBX-382 is an orally available proteolysis-targeting chimeras (PROTACs) that target BTK to inactivate B-cell receptor signaling. UBX-382 shows superior degradation activity for wild-type and mutant BTK proteins and shows anti-cancer activity in murine xenograft models of TMD-8 cells .
    UBX-382
  • HY-120241

    K 251-1

    Phosphodiesterase (PDE) Cancer
    Reticulol (K 251-1) is an inhibitor of cyclic adenosine 3', 5'-monophosphate phosphodiesterase. Reticulol shows antitumor activity independent with cell cycle arrest or apoptosis. Reticulol inhibits cell growth of murine melanoma cells and human lung tumor cells. Reticulol protects its lung metastasis via the bloodstream by inhibiting the growth of B16F10 melanoma .
    Reticulol
  • HY-112041
    Unesbulin
    3 Publications Verification

    PTC596

    Apoptosis Cancer
    Unesbulin (PTC596) is an orally active and selective B-cell-specific Moloney murine leukemia virus integration site 1 (BMI-1) inhibitor. Unesbulin downregulates MCL-1 and induces p53-independent mitochondrial apoptosis in acute myeloid leukemia (AML) cells. Unesbulin has anti-leukemic activity .
    Unesbulin
  • HY-111662

    NOD-like Receptor (NLR) Inflammation/Immunology
    Fc 11a-2, a benzimidazole compound, is an orally active and potent NLRP3 inflammasome inhibitor. Fc 11a-2 restrains the formation of NLRP3 inflammasome by inhibiting activation of caspase-1 and thus the activation of IL-1b/IL-18. Fc 11a-2 prevents the development of Dextran sulfate sodium (DSS; HY-116282C)-induced murine experimental colitis .
    Fc 11a-2
  • HY-120944

    MMP Inflammation/Immunology
    BAY-7598 is a potent, orally bioavailable, and selective MMP12 inhibitor probe with IC50s of 0.085, 0.67 and 1.1 nM for human MMP12, murine MMP12, and rat MMP12, respectively .
    BAY-7598
  • HY-106382

    HIV CMV Infection Cancer
    PMEDAP is a potent inhibitor of human immunodeficiency virus (HIV) replication. PMEDAP has anti-murine cytomegalovirus (MCMV) activity. PMEDAP is a very potent inhibitor of Moloney murine sarcoma virus (MSV)-induced tumor formation and associated mortality .
    PMEDAP
  • HY-W104379

    Parasite Infection
    Arprinocid is a purine analog with activity against murine Toxoplasma gondii .
    Arprinocid
  • HY-155289

    Others Cancer
    DosatiLink-2 is an Abelson murine leukemia (ABL) enzyme inhibitor .
    DosatiLink-2
  • HY-125138

    Endogenous Metabolite Metabolic Disease
    ω-Muricholic acid (ω-MCA) is a murine-specific secondary bile acid .
    ω-Muricholic Acid
  • HY-155290

    Others Cancer
    PonatiLink-1-24 is an Abelson murine leukemia (ABL) enzyme inhibitor .
    PonatiLink-1-24
  • HY-122357

    Adenylate Cyclase Inflammation/Immunology
    Bestim is a dipeptide, which exhibits high affinity to murine peritoneal macrophages, thymocytes, and plasma membranes isolated from these cells, with Kds of 3.1, 2.1, 18.6 and 16.7 nM, respectively. Bestim inhibits adenylate cyclase in the membranes of murine macrophages and thymocytes. Bestim exhibits immunomodulatory efficacy .
    Bestim
  • HY-160850

    Others Endocrinology
    C18 Ceramide-1-phosphate (d18:1/18:0) (ammonium salt) is a specific type of long-chain molecule found in murine skin . C18 Ceramide-1-phosphate (d18:1/18:0) (ammonium salt) promotes migration of both mouse bone marrow-derived multipotent stromal cells and human umbilical vein endothelial cells at concentrations between 0.5-5 µM. C18 Ceramide-1-phosphate (d18:1/18:0) (ammonium salt)’s levels are higher in CFPAC-1 pancreatic ductal adenocarcinoma cells than in pancreatic cancer stem cells .
    C18 Ceramide-1-phosphate (d18:1/18:0) (ammonium salt)
  • HY-P9998

    UB421

    HIV Cancer
    Semzuvolimab is a murine IgG1κ antibody, targeting to p55, T cell surface antigen T4/Leu-3 (CD4). Murine CD4 antibodies can neutralize HIV infection and have the potential to inhibit HAART stable HIV infection .
    Semzuvolimab
  • HY-111749

    JAK Inflammation/Immunology
    JAK-IN-4 is a proagent of a JAK inhibitor, effective in murine collagen induced arthritis model .
    JAK-IN-4
  • HY-109718

    Adenosine Receptor Inflammation/Immunology
    ATL-801, an A2B receptor selective antagonist, ameliorates murine colitis .
    ATL-801
  • HY-P99611

    64G12

    IFNAR Inflammation/Immunology
    Faralimomab (64G12) is an immunomodulator, and a murine anti-IFNA1 IgG1 mAb .
    Faralimomab
  • HY-12458

    DNA/RNA Synthesis Infection Cancer
    Pyrindamycin A is an antibiotic that inhibits DNA synthesis. Pyrindamycin A shows antitumor activities against murine leukemia, exhibits stronger cytotoxic activities towards murine and human tumor cell lines and especially towards doxorubicin-resistant cells, inhibits P388 and P388/ADR cells with the same IC50 of 3.9 μg/ml .
    Pyrindamycin A
  • HY-100448A

    Prostaglandin Receptor TGF-beta/Smad Endocrinology
    Butaprost is a selective prostaglandin E receptor (EP2) agonist with an EC50 of 33 nM and a Ki of 2.4 μM for murine EP2 receptor. Butaprost is less activity against murine EP1, EP3 and EP4 receptors. Butaprost attenuates fibrosis by hampering TGF-β/Smad2 signalling .
    Butaprost
  • HY-N10206

    Endogenous Metabolite Cancer
    11-epi-Chaetomugilin I is a metabolite found in Chaetomium globosum. 11-epi-Chaetomugilin I exhibits significant cytotoxic activity against the murine P388 leukemia cell line, the human HL-60 leukemia cell line, the murine L1210 leukemia cell line, and the human KB epidermoid carcinoma cell line .
    11-epi-Chaetomugilin I
  • HY-P99294

    AMG 479; Human Anti-IGF1R Recombinant Antibody

    IGF-1R Cancer
    Ganitumab (AMG 479) is a recombinant human monoclonal antibody to the human type 1 insulin-like growth factor receptor (IGF1R). Ganitumab recognizes murine IGF1R with sub-nanomolar affinity (KD=0.22 nM) and inhibits the interaction of murine IGF1R with IGF1 and IGF2. Ganitumab can be used in research of cancer .
    Ganitumab
  • HY-132869

    Others Others
    MEIS-IN-1 is a potent myeloid ecotropic viral integration site (MEIS) inhibitor to induce murine and human hematopoietic stem-cell expansion.
    MEIS-IN-1
  • HY-120427

    NSC 658586

    CCR HIV Infection
    Cosalane (NSC 658586) is a potent inhibitor of HIV replication. Cosalane has an intrinsic ability to block human and murine CCR7 function in vitro in response to both of its natural ligands, CCL19 and CCL21, with the IC50 of 0.207/2.66 μM in human for CCL19/CCL21 and 0.193/1.98 μM in murine, respectively .
    Cosalane
  • HY-13535A
    ATN-161 trifluoroacetate salt
    5+ Cited Publications

    ATN-161 TFA salt

    Integrin Cancer
    ATN-161 trifluoroacetate salt is a novel integrin α5β1 antagonist, which inhibits angiogenesis and growth of liver metastases in a murine model.
    ATN-161 trifluoroacetate salt
  • HY-13535

    Integrin Cancer
    ATN-161 is a novel integrin α5β1 antagonist, which inhibits angiogenesis and growth of liver metastases in a murine model.
    ATN-161
  • HY-120333

    Antibiotic Fungal Bacterial Infection
    Antibiotic PF 1052 is an antibiotic extracted from a natural product library. Antibiotic PF 1052 has an inhibitory effect on murine neutrophil migration .
    Antibiotic PF 1052
  • HY-120060

    Parasite Infection
    GNF6702 is a selective inhibitor of the kinetoplastid proteasome. GNF6702 clears parasites in murine models of leishmaniasis, Chagas disease, and human African trypanosomiasis .
    GNF6702
  • HY-13108
    Bz 423
    1 Publications Verification

    BZ48

    Bcl-2 Family Inflammation/Immunology
    Bz 423 is a pro-apoptotic 1,4-benzodiazepine with therapeutic properties in murine models of lupus demonstrating selectivity for autoreactive lymphocytes, and activates Bax and Bak.
    Bz 423
  • HY-114380

    LPL Receptor Others
    Radioprotectin-1 is a potent and specific nonlipid agonist of lysophosphatidic acid receptor 2 (LPA2), with an EC50 value of 25 nM for murine LPA2 subtype .
    Radioprotectin-1
  • HY-U00337A

    DNA/RNA Synthesis Cancer
    Datelliptium chloride hydrochloride is a DNA-intercalating agent derived from Ellipticine (HY-15753). Datelliptium chloride hydrochloride is effective in vivo against a variety of murine solid tumors .
    Datelliptium chloride hydrochloride

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

 

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

 

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: