1. Signaling Pathways
  2. Anti-infection
  3. HBV

HBV

Hepatitis B virus

HBV (Hepatitis B virus), abbreviated HBV, is a species of the genus Orthohepadnavirus, which is likewise a part of the Hepadnaviridae family of viruses. HBV causes the disease hepatitis B. The hepatitis B virus is classified as the type species of the Orthohepadnavirus, which contains three other species: the Ground squirrel hepatitis virus, Woodchuck hepatitis virus, and theWoolly monkey hepatitis B virus. The genus is classified as part of the Hepadnaviridae family. HBV is divided into four major serotypes (adr, adw, ayr, ayw) based on antigenic epitopes present on its envelope proteins, and into eight genotypes (A–H) according to overall nucleotide sequence variation of the genome. The genotypes have a distinct geographical distribution and are used in tracing the evolution and transmission of the virus. Differences between genotypes affect the disease severity, course and likelihood of complications, and response to treatment and possibly vaccination.

Cat. No. Product Name Effect Purity Chemical Structure
  • HY-15142
    Doxorubicin hydrochloride
    Activator 99.90%
    Doxorubicin (Hydroxydaunorubicin) hydrochloride, a cytotoxic anthracycline antibiotic, is an anti-cancer chemotherapy agent. Doxorubicin hydrochloride is a potent human DNA topoisomerase I and topoisomerase II inhibitor with IC50s of 0.8 μM and 2.67 μM, respectively. Doxorubicin hydrochloride reduces basal phosphorylation of AMPK and its downstream target acetyl-CoA carboxylase. Doxorubicin hydrochloride induces apoptosis and autophagy.
    Doxorubicin hydrochloride
  • HY-B0150
    Nicotinamide
    Inhibitor 99.87%
    Nicotinamide is a form of vitamin B3 or niacin. Nicotinamide Hydrochloride inhibits SIRT2 activity (IC50: 2 μM). Nicotinamide also inhibits SIRT1. Nicotinamide increases cellular NAD+, ATP, ROS levels. Nicotinamide inhibits tumor growth and improves survival. Nicotinamide also has anti-HBV activity.
    Nicotinamide
  • HY-N0063
    Punicalagin
    Inhibitor 99.97%
    Punicalagin is a polyphenol ingredient isolated from Pomegranate (Punica granatum L.) or the leaves of Terminalia catappa L.. Punicalagin is a reversible and non-competitive 3CLpro inhibitor and inhibits SARS-CoV-2 replication in vitro. Punicalagin is an anti-hepatitis B virus (HBV) agent and has antioxidant, anti-inflammatory, and anticancer effects. Punicalagin has the potential for the research of COVID-19.
    Punicalagin
  • HY-107454
    OSS_128167
    Inhibitor 98.63%
    OSS_128167 is a potent selective sirtuin 6 (SIRT6) inhibitor with IC50s of 89 μM, 1578 μM and 751 μM for SIRT6, SIRT1 and SIRT2, respectively. OSS_128167 has anti-HBV activity that inhibits HBV transcription and replication. OSS_128167 has anti-cancer, anti-inflammation and anti-viral effects.
    OSS_128167
  • HY-B0250
    Lamivudine
    Inhibitor 99.85%
    Lamivudine (BCH-189) is an orally active nucleoside reverse transcriptase inhibitor (NRTI). Lamivudine can inhibit HIV reverse transcriptase 1/2 and also the reverse transcriptase of hepatitis B virus. Lamivudine salicylate can penetrate the CNS.
    Lamivudine
  • HY-147217A
    Bepirovirsen sodium
    Inhibitor 98.44%
    Bepirovirsen sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).
    Bepirovirsen sodium
  • HY-106233B
    Tiviciclovir hydrochloride
    Inhibitor 99.36%
    Tiviciclovir (AM188) hydrochloride is an antiviral guanosine analog and a hepatitis B virus inhibitor.
    Tiviciclovir hydrochloride
  • HY-N0680R
    Thiamine hydrochloride (Standard)
    Inhibitor
    Thiamine (hydrochloride) (Standard) is the analytical standard of Thiamine (hydrochloride). This product is intended for research and analytical applications. Thiamine hydrochloride (Thiamine chloride hydrochloride) is an essential micronutrient needed as a cofactor for many central metabolic enzymes.
    Thiamine hydrochloride (Standard)
  • HY-W063968
    RO8191
    Inhibitor ≥99.0%
    RO8191 (CDM-3008), an imidazonaphthyridine compound, is an orally active and potent interferon (IFN) receptor agonist. RO8191 directly binds to IFNα/β receptor 2 (IFNAR2) and activates IFN-stimulated genes (ISGs) expression and JAK/STAT phosphorylation. RO8191 shows antiviral activity against both HCV and EMCV with an IC50 of 200 nM for HCV replicon. RO8191 is a cccDNA modulator (CDM) through interferon-like activity and has anti-HBV activity.
    RO8191
  • HY-13910
    Tenofovir
    Inhibitor 99.89%
    Tenofovir (GS 1278) is a nucleotide reverse transcriptase inhibitor to treat HIV and chronic Hepatitis B (HBV).
    Tenofovir
  • HY-B1192
    Estradiol benzoate
    99.89%
    Estradiol benzoate (β-Estradiol 3-benzoate) is a HBx protein inhibitor and inhibits androgen and hepatitis B virus (HBV) transcription, replication. Estradiol benzoate shows antifertility effects, anti- Toxoplasma gondii activity and can improve memory behavior of Ovariectomy (Ovx) female mice.
    Estradiol benzoate
  • HY-13782
    Tenofovir Disoproxil fumarate
    Inhibitor 99.67%
    Tenofovir Disoproxil fumarate is a nucleotide reverse transcriptase inhibitor used to treat HIV and chronic Hepatitis B.
    Tenofovir Disoproxil fumarate
  • HY-15601
    Vesatolimod
    Inhibitor 99.90%
    Vesatolimod (GS-9620) is a potent, selective and orally active agonist of Toll-Like Receptor (TLR7) with an EC50 of 291 nM.
    Vesatolimod
  • HY-N0056
    Isochlorogenic acid A
    Inhibitor 99.54%
    Isochlorogenic acid A (3,5-Dicaffeoylquinic acid) is a natural phenolic acid with anti-mutagenicity, anti-HBV, anti-HIV, anti-oxidant, anti-bacterial, and anti-inflammatoryy activities.
    Isochlorogenic acid A
  • HY-13623A
    Entecavir monohydrate
    Inhibitor 99.66%
    Entecavir monohydrate (BMS200475 monohydrate; SQ34676 monohydrate) is a potent and selective inhibitor of HBV, with an EC50 of 3.75 nM in HepG2 cell.
    Entecavir monohydrate
  • HY-N0820
    Catalpol
    Inhibitor 99.98%
    Catalpol (Catalpinoside), an iridoid glycoside found in Rehmannia glutinosa. Catalpol has neuroprotective, hypoglycemic, anti-inflammatory, anti-cancer, anti-spasmodic, anti-oxidant effects and anti-HBV effects.
    Catalpol
  • HY-117650A
    RG7834
    Inhibitor 99.46%
    RG7834 (RO 7020322) is a highly selective and orally bioavailable HBV inhibitor, potently inhibits HBV antigens (both HBsAg and HBeAg) and HBV DNA, with IC50s of 2.8, 2.6, and 3.2 nM, respectively, in dHepaRG Cells.
    RG7834
  • HY-109137
    Selgantolimod
    Inhibitor 98.23%
    Selgantolimod (GS-9688) is an orally active, potent and selective toll-like receptor 8 (TLR8) agonist for the treatment of hepatitis B virus (HBV) and human immunodeficiency virus (HIV) infection.
    Selgantolimod
  • HY-N0680
    Thiamine hydrochloride
    Inhibitor 99.99%
    Thiamine hydrochloride (Thiamine chloride hydrochloride) is an essential micronutrient needed as a cofactor for many central metabolic enzymes.
    Thiamine hydrochloride
  • HY-B2116
    Osalmid
    Inhibitor 99.85%
    Osalmid is a ribonucleotide reductase small subunit M2 (RRM2) targeting compound; suppresses ribonucleotide reductase activity with an IC50 of 8.23 μM.
    Osalmid
Cat. No. Product Name / Synonyms Application Reactivity